Introduction
Babesia spp. are apicomplexan protozoan parasites, which are the cause of
bovine babesiosis (McCosker
1981), predominantly in exotic cattle in Pakistan (Ali et al.
2016). Globally, babesiosis in cattle is caused by four species of Babesia;
B. bigemina, B. bovis, B. divergens and B. orientalis (Uilenberg
2006; Ica et al. 2007; Altay et al. 2008). Babesia bigemina and B. bovis transmitted
by Rhipicephalus microplus are
prevalent principally with significant economic impact in livestock industry in
Pakistan (Durrani and Kamal 2008; Nieto et al. 2012; Zulfiqar et al. 2012; Hassan et al. 2018; Rehman et al.
2019). Babesia divergens has not been reported in Pakistan (Jabbar et al.
2015), while B. orientalis has been reported recently in scarce
in some parts of Pakistan (Rehman et al.
2019). Microscopy
is not reliable tool for the diagnosis of Babesia bigemina in cattle (Salih et al. 2015) because of misdiagnosis for different Babesia spp. causing babesiosis
in cattle (Böse et al. 1995).
DNA based diagnosis like PCR are
gaining popularity for the detection of parasites nowadays (Wong et
al. 2014).
PCR is more specific and sensitive than microscopic diagnosis of B. bigemina and B. bovis in cattle (Oliveira-Sequeira et
al. 2005).
Babesia infections are difficult to detect
because of the low number of parasites in peripheral blood. PCR
had been developed to detect Babesia spp.
with great advantages, such as high analytical sensitivity and
specificity rates (Criado-Fornelio 2007).
Different PCR formats have been used, one of the first PCR assays
performed was that developed for detection of B.
bigemina
(Figueroa et al. 1992).
PCR can detect Babesia in acute or chronic form of babesiosis
in cattle even with its small number (Calder et al. 1996).
Western blot is an immunoassay which is
primarily used for identifying the immunogens specific for blood parasites like
Theileria annulata (Bilgic
et al. 2016), Leishmania donovani (Singh
and Sundar 2017), Trypanosoma cruzi (Bucio et al. 1999),
Babesia divergens (Gabrielli
et al. 2012), Babesia microti (Ooka et al. 2011)
and Babesia bigemina (Posnett
et al. 1998). The antigens extracted from
erythrocytes infected with Babesia could be used for the evaluation of
immunogens in B.
bovis
(Mahoney et al. 1981)
and B.
bigemina
(Goldman et al. 1972)
infections in cattle. Firstly, we screened the erythrocytes infected with B. bigemina from the field samples through PCR and
then immunogen equivalent to 23 kD was found specific
for B.
bigemina
through Western blot assay. Lastly, ELISA was performed by coating native
antigens to evaluate the antibody titer in experimental B. bigemina-infected calves.
Materials and
Methods
Source of parasite
Babesia
bigemina local strain was obtained from the blood sample of the
calf (designated as K) at the exotic cattle farm located sub-urban of Lahore
(31.4330° N, 74.1945° E), Pakistan. Aseptically, a total of 20 mL of blood was
collected in 50 mL syringe containing Ethylenediamine
Tetra Acetic acid (EDTA) having 18-gauge needle. In order to keep number
of infected erythrocytes (iRBCs) the parasite was maintained in MASP
(MicroAerophilic Stationary Phase) culture system as described (Levy and Ristic 1980) in cell culture
laboratory at the department of Parasitology, University of Veterinary and
Animal Sciences (UVAS), Lahore, Pakistan. To increase the parasitemia, the
iRBCs were inoculated in splenectomized calf (designated as KS) (Mahoney et al.
1973) which was the source of infection for the experimental calves (4
to 6 months of age) designated as A1, A2 and A3. The calves were infected
according to the protocol described elsewhere (Figueroa
et al. 1992). Briefly, 1 × 108 iRBCs were inoculated
in calf (Ramírez et al. 2011) through intravenous route and the infection was
later confirmed through Polymerase Chain Reaction (PCR). The collection and
inoculation of B. bigemina, is
outlined in Fig. 3.
Primer
design and PCR
A pair of
oligonucleotides was designed for targeting the 18S ribosomal RNA gene. The
sequences of different isolates of B.
bigemina and B. bovis were
retrieved from Genbank and were aligned initially by BioEdit
software (Hall 1999) and then consensus
sequence was created. Then, the primers were designed by using Geneious R8 software (Talundzic
et al. 2015). Genomic DNA was
extracted from 200 µL of blood samples through DNA extraction kit
(GeneAll®, Exgene™, 105-101) according to the manufacturer instructions, while
quantity of DNA was measured through NanoDrop spectrophotometer (Thermo Scientific 2000/2001, Wilmington, DE 19810, USA). PCR was
used for confirmation of B. bigemina
and B. bovis by using specific primer pairs: Bg-forward:
AGAGGGACTCCTGTGCTTCA, Bg-reverse: GACGAATCGGAAAAGCCACG and Bv-forward:
AATATGGGTTGGGCAATGCG, Bv-reverse CCACCCAAAACAAGAGCAACT, respectively. PCR was
performed according to the protocol described elsewhere (Mtshali and Mtshali 2013; Farooqi et
al. 2017) with little modifications. Briefly, PCR reaction was
carried out in 20 µL of reaction mixture containing 1 µL of each
primer pair (10 pmol), 2 µL of DNA, 10 µL of 2X AmpMaster™ Taq
(GeneAll®, Exgene™, 541-001) and 6 µL of UltraPure™ DEPC water (Cat no.
750023; Invitrogen, Carlsbad, CA, USA). The control samples were run for each
reaction. The annealing temperature was 60°C for B. bigemina and 56°C
for B. bovis with 35 cycles each for the PCR reaction. The amplified DNA
was subjected for electrophoresis in 1.5% agarose gel (120 V, 200 mA, 45 min)
stained with ethidium bromide (Cat no. 15585-011; Invitrogen, Carlsbad, CA, USA)
and observed under GelDoc 100 imaging system. DNA ladder of 100 bp (Genedirex,
Catlogue # DM001-R500) was used to compare the amplified product of PCR.
Preparation of native antigens
Merozoites of B. bigemina
were harvested from iRBCs according to the protocol
described elsewhere (Ruiz et al. 2001) with modifications as follows. Twenty
milliliters of whole blood were centrifuged for plasma and erythrocyte
separation at 1000 × g (BIOShield Swing-out Bucket
Rotor, Catalogue # 75003182, Thermo Fischer,) at 4°C for 6 min. Supernatant was
discarded and the pellet of cells was washed thrice with 1X Phosphate Buffer
Saline (PBS) following centrifugation at 1000 × g.
Immediately after centrifugation, the pellet was treated with 3 parts of cold
ammonium chloride lysis buffer (0.17 M)
for one minute (Podoba and Stevenson 1991).
Reaction was stopped by adding RPMI-1640. The
mixture was centrifuged at 1000 × g for 15 min and the erythrocyte-free pellet was washed three times in
PBS. The pellet was resuspended in 5 volumes of PBS containing protease
inhibitor (1 mM PMSF, 2 mM TPCK and 0.1 mM TLCK). B.
bigemina merozoites were disrupted by repeated freeze/thaw method in liquid
nitrogen. The supernatant obtained after centrifugation at 10,000 × g for 1 h at 4°C was stored at -20°C. Quantification of the Ag was
assessed through BCA Kit
(Bicinchoninic Acid) (Cat. 786-570, G-Biosciences®), following manufacturer’s
protocol. Antigens were prepared for SDS-PAGE, Western Blot analysis and
Enzyme Linked Immuno-Sorbent Assay (ELISA). Antigens from splenectomized calves
were prepared after each month for 12 months post-infection.
Collection of sera
The sera were collected from
the animals (A1, A2, A3, K and N). The calves (A1, A2 and A3) were infected
experimentally with iRBCs containing B. bigemina from the splenectomized calf while K and N samples were obtained from
natural B. bigemina-infected calf at acute stage of the disease and Babesia-free calf, respectively.
Absence or presence of infection was confirmed through PCR. N was kept as
negative control, which was collected from the calf of tick-free area. Blood of
N was screened negative for any parasite through microscopy and PCR. The sera
were collected from experimentally infected calves (A1, A2, and A3) in tubes
after 15 days and 30 days post-infecton without anticoagulant and were stored
at -20°C. The sera were collected from splenectomized calf every month until 12
months post-infection.
SDS-PAGE and immunoblotting
Native antigens were analyzed through Sodium Dodecyl
Sulphate Polyacrylamide gel electrophoresis (SDS-PAGE) and Western Blot
according to the protocol described elsewhere (Nabi
et al. 2017). In Brief, 10 µg
of native antigens were loaded on each lane, separated by (12% w/v) polyacrylamide
gel and transferred to nitrocellulose membranes (NCM, 0.22 µm, Trans-Blot® Turbo™ Midi nitrocellulose transfer
packs#1704159, Bio-Rad, USA) using Trans-Blot® Turbo™ transfer
system (Bio-Rad, USA). Blots were cut into strips, labeled and blocking was
achieved with skimmed milk (5% w/v) in TBS buffer (Tris-buffered saline 20 mM
Tris-HCl, pH 7.2, 150 mM NaCl). Sera collected from infected animals
were used as a source of primary antibody. Following washing, the strips were
then charged with goat anti-bovine
IgG-alkaline phosphatase conjugate (1:10,000) secondary
antibodies (ThermoFisher USA, Catalogue # A18754.
NBT/BCIP (bioWORLD, USA) was used as chromogenic
substrate.
Indirect ELISA
ELISA was performed according to the protocol described
elsewhere (Ruiz et al. 2001; Naeem et al. 2018). Briefly, 5 µg/mL
or 10 µg/mL of native antigens were coated in 96 well ELISA plate
(BIOFIL®, Guangzhou, China) in 50 mM bicarbonate buffer,
incubated at 4şC overnight. The ELISA plates were washed 3 times with washing
buffer (0.05% Tween 20, 0.01 M PBS, pH
7.2). Saturation of the microtiter plate was done with 4% BSA in PBS followed
by incubation at 37şC for 2 h. Both negative and positive sera were diluted in
PBS to achieve two-fold serial dilutions. Diluted sera were poured into each
well. The plate was incubated again at 37şC for 1 h. Second washing was
performed with washing buffer as described previously. Bound antibodies were
detected by incubating at 37şC for 2 h with goat anti-bovine IgG-alkaline
phosphatase conjugate (1:10,000). After washing thrice, phosphatase activity
was measured with P-nitrophenyl phosphate (pNPP, Cat. 41480004-1, Bioworld® USA) at 1 mg/mL in 1 M
diethanolamine (Cat. 40400060-3, Bioworld®). Optical density (OD)
values were obtained by ELISA reader (Elisa reader, Model ELx
800, BioT, USA) at wavelength of 405 nm.
Results
PCR
Field blood samples of B.
bigemina-infected, B. bovis-infected and experimental B.
bigemina-infected animals were confirmed through PCR. Product sizes; 321 bp
and 269 bp, were obtained along with control positive DNA for B. bigemina
and B. bovis, respectively as shown in Fig. 1. The PCR products were
also confirmed through sequencing.
Identification
of B. bigemina-specific immunogen
Infected
or non-infected RBCs were analyzed through SDS-PAGE. Several bands of various
sizes were revealed through Coomassie Blue staining (Fig. 2A). SDS-PAGE was
also done with crude antigens harvested from iRBCs of splenectomized calf at 12
months post-infection. The gel then, was transferred
to the nitrocellulose membrane and it was immuno-blotted with B. bigemina-positive,
B. bovis-infected and negative sera. The blots
revealed a specific band of about 23 kD when they were
incubated with B. bigemina-positive
serum sample. The blots incubated with negative and B. bovis
sera, did not reveal any specific band at 23 kD (Fig.
2B).
Analysis
of IgG antibodies through Indirect ELISA
Immune response in B. bigemina-infected intact
calves were evaluated against 5 µg/mL and 10 µg/mL concentrations
of native antigens through indirect ELISA. The antibody titer in experimentally
infected calves with B. bigemina was from 149 ± 97.8 to 299 ± 196 in
wells coated with 5 µg/mL while this titer was
from 597 ± 391 to 1195
± 782 in wells coated with 10 µg/mL
of native antigens. The antibody titer was observed in 3 calves at 15 days and
30 days post-infection. This titer was not significant between the two
concentrations.
Discussion
We
screened the erythrocytes infected with B.
bigemina
from the field samples through PCR. Splenectomized calf was infected with iRBCs
from naturally infected calf and then 23 kD immunogen
specific for B.
bigemina
was identified through Western blot assay in B.
bigemina-infected
splenectomized calf at its carrier state. Finally, ELISA was performed with
native antigens to find out the antibody titer in B. bigemina-infected intact calves.
Fig. 1: PCR results of blood samples
for Babesia bigemina
and Babesia bovis.
L is 100 bp ladder. A1 and
A2 are experimentally infected animals. K1 and BV are field samples positive
for B. bigemina and B. bovis
respectively. CB and CV are control positive DNA of B. bigemina
and B. bovis respectively. 321 bp and 269 bp are PCR products of
B. bigemina and B. bovis
respectively. N1 is the control negative DNA. PCR was performed at least n=3 to
confirm the results
Fig. 2: Vertical gel electrophoresis
and Western-blot analyses in non-reducing conditions. (A) SDS-PAGE
analysis stained with Coomassie blue. M is protein
marker. B and K are total lysate of B. bovis
and B. bigemina respectively. N is the total
lysate of control negative sample. (B) Western-blot results. M is
protein marker. B and K are positive serum samples of B. bovis
and B. bigemina respectively. N is the
negative serum sample. About 23 kD
protein band was revealed with serum sample of B. bigemina
while B and N did not reveal any specific band when the blot was
transferred from gel run with total lysate of B. bigemina.
SDS-PAGE and Western Blot analyses were performed at least n=3 to confirm
the results
Fig. 3: Evaluation of IgG antibodies through ELISA by coating 5 and 10 µg/mL
of antigens. Serum samples of
all experimental B. bigemina-infected animals
were tested with 2-fold serial dilutions. (A) graph
plotted with Antibody titer, and (B) graph plotted with Log2 values.
ELISA was performed at least n=3 to get an average of the results
DNA based diagnosis like PCR are
gaining popularity for the detection of parasites nowadays (Wong et al. 2014).
PCR is more specific and sensitive than microscopic diagnosis of B. bigemina and B. bovis in cattle (Oliveira-Sequeira et al. 2005).
PCR can detect Babesia in acute or chronic form of babesiosis in cattle even with its small number (Calder et al. 1996).
We have detected Babesia
bigemina
and Babesia
bovis
infections from the infected cattle through PCR. We achieved 321 bp and
269 bp PCR products by using specific primers for
B. bigemina and B. bovis, respectively. Nested or semi-nested PCR is used for the
differential diagnosis of B. bigemina and B. bovis on non-quantitative
thermal cycler (Herrera et
al.
2017; Sivakumar et al. 2018). Oliveira-Sequeira et al. (2005) used two
sets of primer pairs (external and internal primer pairs) for two round PCRs.
They achieved 278 bp and 350 bp PCR products for the detection of B. bigemina and B. bovis respectively by
using external primers. Our primers were more specific because we did only
single round PCR. Nested PCR is needed when external primer pair is less specific (Szöllősi
et al. 2008). Dissimilar to our results, Durrani and
Kamal (2008) obtained 1124 bp and 541 bp product sizes through molecular detection
of B.
bigemina
and B.
bovis,
respectively (Durrani and Kamal 2008).
The difference in results is due to the use of different primer pairs.
Merozoite is the invasive stage in the
life cycle of Babesia, which has surface antigens (Madruga et
al. 1996)
serve as receptors to get attachment with ligands on the RBCs (Yokoyama et al. 2002).
Immunoassays like western blot technique can be used for the identification of
immunogens of different Babesia
spp. like B. divergens (Gabrielli
et al. 2012),
B. microti
(Ooka et al. 2011), and B. bigemina (Posnett
et al. 1998).
The antigens extracted from erythrocytes infected with the Babesia could be used for the evaluation of
immunogens in B.
bovis
(Mahoney et al. 1981) and B. bigemina (Goldman
et al. 1972)
infections in cattle. We have identified an immunogen about the size of 23 kD
from B.
bigemina
isolate propagated in splenectomized calf by immuno-blotting its native
antigens with the sera of B.
bigemina
and B.
bovis
-infected cattle. Our splenectomized calf became carrier of B.
bigmenia.
Previously, splenectomized calf had been used for the propagation of Babesia
spp. (Callow
et al. 1979; Mahoney et al. 1981; Figueroa et al. 1992; Posnett et al. 1998). We obtained only single band of protein
at carrier state of splenectomized calf as compared to the acute state of the
babesiosis caused by B. bigemina, while in acute state we obtained
numerous bands through western blot analysis (Data not shown). Kahl et al. (1982) have demonstrated the
variation of protein expressions between virulent and avirulent strains of B.
bovis
through 2-D gel electrophoresis. Montenegro-James et al. (1987) obtained immunogens of 23, 26
and 29 kD from merozoites of B. bigemina strain isolated from Venezuela through
western-blot analysis by incubating with homologous serum sample (Montenegro-James et al. 1987).
Posnett et
al.
(1998) transferred the native antigens from Kenyan strain of B. bigemina to the nitrocellulose membrane from
SDS-PAGE gel and immuno-blotted with sera of B. bigemina Kenyan strain-infected, B. bigemina Mexican strain-infected and B. bovis-infected cattle. They found about 50 kD immunogen specific for Kenyan strain of B. bigemina only, which was not recognized by the
sera of both Mexican strain of B.
bigemina
and B.
bovis
(Posnett et al. 1998). Environmental factors, genetic
variation and host adaptability of pathogen may determine the phenotype of the
parasite (Kaltz and Shykoff 1998; Gandon and
Michalakis 2002). Moreover, splenectomized calf was used for propagation
of vaccine strains to get high parasitemia and it may become carrier or premuned (Hussein 1977).
Immuo-assays like IFAT and ELISA have
been used employing native or crude antigens (Böse
et al. 1995; Pipano et
al. 2002; Shkap et
al. 2007)
to evaluate vaccine response against babesiosis caused by B. bigemina. ELISA has been used for the detection
of B.
bigemina
(Molloy et al. 1998; Battsetseg et
al. 2018; Jaramillo et
al. 2018; Sivakumar et al. 2018; Obregon et
al. 2019),
which is more cost-effective than IFAT (Böse et al. 1995).
There are several cross-reactive proteins between B. bigemina and B. bovis (Figueroa
et al. 2006) so specific protein would be feasible
to be used for development of ELISA against B. bigemina in naturally infected animals. Our B. bigemina-specific 23 kD
protein could be used for specific ELISA in both acute and carrier states (Löhr 1972; Goo et al. 2009)
either in native or recombinant protein form as a source of antigen after
characterization.
We used
ELISA coated with native antigens of B.
bigemina for the evaluation of humoral immune response of experimentally
infected intact calves. ELISA with native antigens is not considered fit to
evaluate immune response in naturally infected animals because there are
similarities of antigens between B. bigemina and B. bovis (Morzaria et al. 1992). Native antigens of B.
bigemina had been used to detect antibodies (Goldman
et al. 1972) by using IFAT (Bessenger
and Schoeman 1983) and ELISA (El-Ghaysh et al. 1996). Bessenger and Schoeman (1983) has obtained antibody titer of
170 ± 114.9 and
480 ± 184.8 at 3rd
and 4th week respectively, in post B. bigemina-infected
animals by using IFAT (Bessenger and Schoeman
1983). E1-Ghaysh et al. (1996) coated the ELISA plates with 12 µg/mL
native antigens with 1/10,000 dilution of conjugate. They evaluated 2 positive
sera of B. bigemina 2–4 week-infected cattle
and obtained the optical density (OD) value of 1.425 ± 0.4596 (El-Ghaysh et
al. 1996). We obtained antibody titer of 149 ± 97.8 to 299 ± 196 (OD
value: 1.657 ± 0.1066) in
wells coated with 5 µg/mL of native antigens while this titer was from
597 ± 391 to 1195
± 782 (1.717 ± 0.2071) in wells coated with 10 µg/mL of
antigens. The variation in results is due to the difference of B. bigemina
strains and quantity of antigen coated.
Conclusion
Immunogenic
protein of about the size of 23 kD was found specific for our local B. bigemina strain in splenectomized calf at its
carrier state 12 months post-infection. ELISA was performed with native
antigens to find out the antibody titer in B. bigemina-infected intact calves. This immunogen
specific to B.
bigemina
will be characterized and its diagnostic value will be determined in future.
Acknowledgements
This study was funded by Higher Education Commission,
Islamabad, Pakistan (HEC) in National Research Grant for Public sector
Universities (NRPU) under Grant No.
7173/Punjab/NRPU/R&D/HEC/2017. The Authors are whole heartedly thankful to
Dr. Susan Noh, Diplomate, American College of Veterinary Pathology, Research
Veterinary Medical Officer, USDA-ARS Animal Disease Research Unit and
Department of Veterinary Microbiology and Pathology, Washington State
University for the provision of control positive DNA of Babesia bigemina and
Babesia bovis. We thank Dr. David S. Lindsay, Virginia-Maryland College
of Veterinary Medicine, Virginia Tech, Blacksburg, Virginia, USA, for
suggestions on the manuscript. We also acknowledge Prof. Dr. Asim Khalid
Mahmood and Dr. Uzma Farid Durrani from Pet Center
UVAS for doing surgery for splenectomy of the calf.
Ethical Approval
The study was approved from the animal welfare and ethic
society of University of Veterinary and Animal Sciences Lahore, Pakistan with
No. DR 1112, Dated: 13-10-2017. All the animals were treated after experiments.
Author Contributions
Conceptualization, Muhammad Imran
Rashid, Haroon Akbar, Aneela Zameer Durrani; methodology, Muhammad Imran
Rashid, Haroon Akbar; formal analysis,
Muhammad Imran Rashid, Haroon Akbar; investigation, Umber Rauf, Shafqat Shabir,
Matiullah Khan, Imran Rashid, Haroon Akbar; resources, Muhammad Imran Rashid,
Haroon Akbar; data curation,
Umber Rauf, Shafqat Shabir, Matiullah Khan writing—original draft preparation, Muhammad Imran Rashid, Umber
Rauf, Shafqat Shabir, Matiullah Khan; writing—review
and editing, Muhammad Imran Rashid, Umber Rauf, Shafqat Shabir,
Matiullah Khan, Haroon Akbar, Aneela Zameer Durrani; visualization, Muhammad Imran Rashid, Haroon Akbar, Umber Rauf,
Shafqat Shabir, Aneela Zameer Durrani; project
administration, Muhammad Imran Rashid, Haroon Akbar; funding
acquisition, Muhammad Imran Rashid, Haroon Akbar
References
Ali S, M Ijaz, AZ Durrani, A Maqbool, MM
Ali, K Mehmood (2016). Epidemiological
Aspects of Bovine Tick Infestation in the River Ravi Region, Lahore. Pak J
Zool 48:563–567
Altay K, MF Aydin,
N Dumanli, M Aktas (2008). Molecular detection of
Theileria and Babesia infections in cattle. Vet Parasitol 158:295‒301
Battsetseg B, T
Sivakumar, K Naranbaatar, S Narantsatsral, P Myagmarsuren, B Enkhtaivan, B
Davaasuren, D Mizushima, G Weerasooriya, I Igarashi, B Battur, N Yokoyama (2018). Serosurvey of Babesia bovis and Babesia
bigemina in cattle in Mongolia. Vet Parasitol
Reg Stud Rep 13:85‒91
Bessenger R, JH Schoeman (1983). Serological response of cattle to
infection with Babesia bigemina and Babesia bovis in southern
Africa. Onderstep J Vet Res 50:115‒117
Bilgic HB, T
Karagenc, S Bakirci, B Shiels, A Tait, J Kinnaird, H Eren, W Weir (2016). Identification and analysis of immunodominant
antigens for ELISA-based detection of Theileria
annulata. PLoS One 11; Article e0156645
Böse R, W
Jorgensen, R Dalgliesh, K Friedhoff, AD Vos (1995). Current state and future trends in the diagnosis
of babesiosis. Vet Parasitol 57:61‒74
Bucio MI, M
Cabrera, EL Segura, E Zenteno, M
Salazar-Schettino (1999). Identification of immunodominant antigens in Mexican
strains of Trypanosoma cruzi. Immunol Invest 28:257‒268
Calder JA, GR
Reddy, L Chieves, CH Courtney, R Littell, JR Livengood, RA Norval, C Smith, JB Dame (1996). Monitoring Babesia bovis infections in cattle
by using PCR-based tests. J Clin
Microbiol 34:2748‒2755
Callow L, L Mellors, W McGregor (1979). Reduction in virulence of Babesia bovis due to rapid passage in
splenectomized cattle. Intl J Parasitol 9:333‒338
Criado-Fornelio A
(2007). A review of nucleic acid-based diagnostic tests for Babesia and Theileria, with emphasis on bovine piroplasms. Parassitologia 49:39–44
Durrani AZ, N Kamal (2008). Identification of ticks and detection of
blood protozoa in friesian cattle by polmerase chain reacton test and
estimation of blood parameters in district Kasur, Pakistan. Trop Anim Health Prod 40:441‒447
El-Ghaysh A, B
Sundquist, DA Christensson, M Hilali, AM
Nassar (1996). Observations on the use of ELISA for detection of Babesia bigemina specific antibodies. Vet Parasitol 62:51‒61
Farooqi SH, M Ijaz, MI Rashid, AI Aqib, Z
Ahmad, MH Saleem, K Hussain, S Islam, H Naeem, A
Khan (2017). Molecular epidemiology of Babesia
bovis in bovine of Khyber Pakhtunkhwa, Pakistan. Pak Vet J 37:275‒280
Figueroa JV, E
Precigout, B Carcy, A Gorenflot (2006). Identification of
common antigens in Babesia bovis, B. bigemina, and B. divergens. Ann N Y Acad Sci 1081:382‒396
Figueroa JV, LP
Chieves, GS Johnson, GM Buening (1992).
Detection of Babesia bigemina-infected carriers by polymerase chain reaction
amplification. J Clin Microbiol
30:2576‒2582
Gabrielli S, R Galuppi, F Marcer, C Marini, MP
Tampieri, A Moretti, M Pietrobelli, G
Cancrini (2012). Development of culture-based serological assays to diagnose Babesia divergens infections. Vect Borne Zoonot Dis 12:106‒110
Gandon S, Y Michalakis (2002). Local adaptation, evolutionary potential
and host–parasite coevolution: Interactions between migration,
mutation, population size and generation time. J Evol Biol 15:451‒462
Goldman M, E
Pipano, AS Rosenberg (1972). Fluorescent
Antibody Tests for Babesia bigemina
and B. berbera. Res Vet Sci 13:77‒82
Goo YK, H Jia, MA
Terkawi, GO Aboge, J Yamagishi, Y Nishikawa, S Kim, H-K Jang, K Fujisaki, X Xuan (2009). Babesia
gibsoni: Identification, expression,
localization, and serological characterization of a Babesia gibsoni 22-kDa protein. Exp Parasitol 123:273‒276
Hall TA (1999).
BioEdit: A user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/NT. Nucleic acids
symposium series, [London]: Information Retrieval Ltd., c1979‒c2000
Hassan MA, J Liu, M Rashid, N Iqbal, G Guan, H
Yin, J Luo (2018). Molecular survey of
piroplasm species from selected areas of China and Pakistan. Parasit Vect 11:457-63
Herrera PCT, VV
Viloria, MM Balbin, CN Mingala (2017). Prevalence of
babesiosis (Babesia bovis and Babesia bigemina) in cattle and water
buffalo in Nueva Ecija, Philippines using Nested Polymerase Chain Reaction. Ann Parasitol 63:309‒316
Hussein H (1977).
The nature of immunity against Babesia
hylomysci and B. microti
infections in mice. Ann Trop Med Parasit 71:249‒253
Ica A, Z
Vatansever, A Yildirim, O Duzlu, A Inci (2007).
Detection of Theileria and Babesia species in ticks collected from
cattle. Vet Parasitol 148:156‒160
Jabbar A, T Abbas,
HA Saddiqi, MF Qamar, RB Gasser (2015).
Tick-borne diseases of bovines in Pakistan: Major
scope for future research and improved control. Parasit Vect 8; Article 283
Jaramillo Ortiz
JM, VN Montenegro, SAMDL Fourniere, NF
Sarmiento, MD Farber, SE Wilkowsky
(2018). Development of an indirect elisa based on a recombinant chimeric
protein for the detection of antibodies against bovine babesiosis. Vet Sci 5:13
Kahl L, R Anders,
B Rodwell, P Timms, G Mitchell (1982). Variable and common
antigens of Babesia bovis parasites
differing in strain and virulence. J Immunol 129:1700‒1705
Kaltz O, JA Shykoff (1998). Local adaptation in host–parasite systems.
Heredity 81:361–370
Levy MG, M Ristic (1980). Babesia bovis: Continuous cultivation in a microaerophilous stationary phase
culture. Science 207:1218‒1220
Löhr KF (1972).
Immunity to Babesia bigemina in
experimentally infected cattle. J Protozool 19:658‒660
Madruga CR, CE
Suarez, TF McElwain, GH Palmer (1996).
Conservation of merozoite membrane and apical complex B cell epitopes among Babesia bigemina and Babesia bovis strains isolated in
Brazil. Vet Parasitol 61:21‒30
Mahoney DF, IG Wright, BV Goodger (1981). Bovine babesiosis: The immunization of cattle with fractions of erythrocytes
infected with Babesia bovis (syn B. argentina). Vet Immunol Immunopathol 2:145‒156
Mahoney DF, IG Wright, GB Mirre (1973). Bovine
babesiasis: The persistence of immunity to Babesia argentina and B. bigemina in calves (Bos taurus) after naturally acquired
infection. Ann Trop Med Parasitol
67:197‒203
McCosker P (1981). The global importance of
babesiosis. In: Babesiosis, pp:1–24. Ristic M, JP Kreier (Eds.). Academic Press, London
Molloy J, P
Bowles, P Jeston, A Bruyeres, J Bowden, R Bock, W Jorgensen, G Blight, R Dalgliesh (1998). Development of an enzyme-linked
immunosorbent assay for detection of antibodies to Babesia bigemina in cattle. Parasitol Res 84:651‒656
Montenegro-James S, MT Benitez, E Leon, R Lopez, M Ristic (1987). Bovine babesiosis: Induction of protective immunity with culture-derived Babesia bovis and Babesia bigemina immunogens. Parasitol Res 74:142‒150
Morzaria S, J
Katende, A Kairo, V Nene, A Musoke (1992).
New methods for the diagnosis of Babesia
bigemina infection. Mem Inst Oswaldo
Cruz 87 3:201‒205
Mtshali MS, PS
Mtshali (2013). Molecular diagnosis and phylogenetic analysis of Babesia bigemina and Babesia bovis hemoparasites from cattle
in South Africa. BMC Vet Res 9; Article 154
Nabi H, I Rashid,
N Ahmad, A Durrani, H Akbar, S Islam, AA Bajwa, W Shehzad, K Ashraf, N Imran (2017). Induction of specific humoral immune response
in mice immunized with ROP18 nanospheres from Toxoplasma gondii. Parasitol
Res 116:359‒370
Naeem H, M Sana, S Islam, M Khan, F Riaz, Z
Zafar, H Akbar, W Shehzad, I Rashid (2018).
Induction of Th1 type-oriented humoral response through intranasal immunization
of mice with SAG1-Toxoplasma gondii
polymeric nanospheres. Artif Cells
Nanomed Biotechnol 46:1025‒1034
Nieto NC, K Khan,
G Uhllah, MB Teglas (2012). The emergence and
maintenance of vector-borne diseases in the khyber pakhtunkhwa province and the
federally administered tribal areas of Pakistan.
Front Physiol 3; Article 250
Obregon D, A Cabezas-Cruz,
Y Armas, JB Silva, AH Fonseca, MR Andre, P Alfonso, MCS Oliveira, RZ Machado, B Corona-Gonzalez (2019). High co-infection rates of Babesia bovis, Babesia bigemina, and Anaplasma
marginale in water buffalo in Western Cuba. Parasitol Res 118:955‒967
Oliveira-Sequeira
TC, MC Oliveira, JP Araujo, AF
Amarante (2005). PCR-based detection of Babesia
bovis and Babesia bigemina in
their natural host Boophilus microplus and
cattle. Intl J Parasitol 35:105‒111
Ooka H, MA
Terkawi, YK Goo, Y Luo, Y Li, J Yamagishi, Y Nishikawa, I Igarashi, X Xuan (2011). Babesia
microti: Molecular and antigenic
characterizations of a novel 94-kDa protein (BmP94). Exp Parasitol 127:287‒293
Pipano E, V Shkap, Y Kriegel, B Leibovitz, I
Savitsky, L Fish (2002). Babesia bovis and B. bigemina:
Persistence of infection in friesian
cows following vaccination with live antibabesial vaccines. Vet J 164:64‒68
Podoba JE, MM Stevenson (1991). CD4+ and CD8+
T lymphocytes both contribute to acquired immunity to blood-stage Plasmodium chabaudi AS. Infect Immun
59:51‒58
Posnett ES, E Metaferia, S Wiliamson, CG Brown, EU Canning (1998). In
vitro cultivation of an African strain of Babesia bigemina, its characterisation and infectivity in cattle. Parasitol Res 84:302‒309
Ramírez EER, JJM
Gualito, JAÁ Martínez, RH Ortíz, JAR Aragón, CR Martěnez, CAVY Murguia, JVF Millán (2011).
Transmissibility of Babesia bigemina
and Babesia bovis attenuated strains
by Rhipicephalus (Boophilus) microplus ticks. Rev Mex Cienc Pec 2:267-281
Rehman A, FJ
Conraths, C Sauter-Louis, J Krucken, AM
Nijhof (2019). Epidemiology of tick-borne pathogens in the semi-arid and the
arid agro-ecological zones of Punjab Province,
Pakistan. Transbound Emerg Dis 66:526‒536
Ruiz PM, LM Passos, RZ Machado, JD Lima, MF Ribeiro (2001). Development of an enzyme-linked
immunosorbent assay for detection of IgM antibodies to Babesia bigemina in cattle. Mem
Inst Oswaldo Cruz 96:237‒240
Salih D, AE
Hussein and L Singla (2015). Diagnostic approaches for tick-borne
haemoparasitic diseases in livestock. J Vet Med Anim Health 7:45‒56
Shkap V, I
Rasulov, S Abdurasulov, L Fish, B Leibovitz, Y Krigel, T Molad, M Mazuz, I Savitsky (2007). Babesia
bigemina: Attenuation of an Uzbek isolate for immunization of cattle with
live calf-or culture-derived parasites. Vet Parasitol 146:221‒226
Singh N, S Sundar (2017). Integrating genomics and proteomics permits
identification of immunodominant antigens associated with drug resistance in
human visceral leishmaniasis in India. Exp
Parasitol 176:30‒45
Sivakumar T, DTB
Lan, PT Long, LQ Viet, G Weerasooriya, A Kume, K Suganuma, I Igarashi, N Yokoyama (2018). Serological and molecular surveys of Babesia bovis and Babesia bigemina among native cattle and cattle imported from
Thailand in Hue, Vietnam. J Vet Med Sci
80:333‒336
Szöllősi E, O
Hellgren, D Hasselquist (2008). A Cautionary Note
on the Use of Nested PCR for Parasite Screening: An Example from Avian Blood
Parasites. J Parasitol 94:562‒564
Talundzic E, SM Chenet, IF Goldman, DS Patel, JA
Nelson, MM Plucinski, JW Barnwell, V
Udhayakumar (2015). Genetic analysis and species specific amplification of the
artemisinin resistance-associated kelch propeller domain in P. falciparum and P. vivax. PLoS One 10; Article e0136099
Uilenberg G (2006). Babesia–a historical overview. Vet Parasitol 138:3‒10
Wong SS, KS Fung,
S Chau, RW Poon, SC Wong, KY Yuen (2014).
Molecular diagnosis in clinical parasitology: When
and why? Exp Biol Med 239:1443‒1460
Yokoyama N, B Suthisak, H Hirata, T Matsuo, N
Inoue, C Sugimoto, I Igarashi (2002). Cellular
localization of Babesia bovis
merozoite rhoptry-associated protein 1 and its erythrocyte-binding activity.
Infect Immun 70:5822‒5826
Zulfiqar S, S Shahnawaz, M Ali, AM
Bhutta, S Iqbal, S Hayat, S Qadir, M Latif, N Kiran, A Saeed, M Ali, F Iqbal
(2012). Detection of Babesia bovis in
blood samples and its effect on the hematological and serum biochemical profile
in large ruminants from Southern Punjab. Asian
Pac J Trop Biomed 2:104‒108